Skip to main content Skip to navigation
Oligo Hamster Anti-Mouse FcγRIV (CD16-2)

BD™ AbSeq Oligo Hamster Anti-Mouse FcγRIV (CD16-2)

Clone 9E9

Product Details
Down Arrow Up Arrow


BD™ AbSeq
CD16-2; Fcgr4; FcgRIV; Fc gammaRIV; FcgammaRIV; Fcgr3a; Fcrl3
246256
2 µl
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GCACGGCATAGGTTGAATTGGTTGACGATCTGTAGG
AMM2126
Mouse FcγRIV Recombinant Protein
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
Armenian Hamster


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

940338 Rev. 1
Antibody Details
Down Arrow Up Arrow
9E9

The 9E9 monoclonal antibody specifically binds to Fc receptor, IgG, low affinity IV (Fc γ RIV), which is also known as CD16-2. Fc γ RIV is encoded by Fcgr4 and belongs to the family of receptors for the Fc region of IgG (Fc γ Rs), which also includes Fc γ RI (CD64), Fc γ RII (CD32), and Fc γ RIII (CD16) within the Ig superfamily. FcγRIV is expressed on monocytes, macrophages, dendritic cells, and neutrophils. FcγRIV, w hich serves as a ligand-biding subunit, requires the common Fcγ chain for expression and signaling . This complex serves as a cell activating receptor when bound by IgG2a or IgG2b. Fc γ RIV plays various roles in inflammation including neutrophil trafficking and mast cell degranulation. FcγRIV can also function as a low-affinity IgE receptor and promote IgE-induced inflammation. The 9E9 antibody can reportedly inhibit cellular FcγRIV (CD16-2) function and block non-antigen-specific binding of immune com plexes to improve the quality of immunological assays.

Application Notes

The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.

NOTE: The BD Rhapsody Single-Cell Analysis System must be used with the BD Rhapsody Express Instrument.

940338 Rev. 1
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms. NOTE: The BD Rhapsody Single-Cell Analysis System must be used with the BD Rhapsody Express Instrument.
Antibody-Oligo
940338 Rev.1
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940338" on CiteAb
No Citations Found

No Citations Are Available for this Product

940338 Rev. 1

Please refer to Support Documents for Quality Certificates

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.